PO multiple alignment format

From BioPerl
Jump to: navigation, search

Contents

Description

TODO:

Used by POA software [1].

References

  1. Lee C, Grasso C, and Sharlow MF. Multiple sequence alignment using partial order graphs. Bioinformatics. 2002 Mar;18(3):452-64. PubMed ID:11934745 | HubMed [poa_cite]

Example

Input

>Seq1 variant A
AGGCTTCGGATTATTATATTCTCCCCCTTAT
>Seq2 variant B
AGGCTTCGGTCGGATTATATTATTCTCTTAT
>Seq3 variant C
TTCTAGGCTTCATTACTTATATTCTCCCCCCTAT

Output

VERSION=LPO.0.1
NAME=Seq1
TITLE=variant A
LENGTH=44
SOURCECOUNT=3
SOURCENAME=Seq1
SOURCEINFO=31 0 1 -1 variant A
SOURCENAME=Seq2
SOURCEINFO=31 0 1 -1 variant B
SOURCENAME=Seq3
SOURCEINFO=34 0 1 -1 variant C
T:S2
T:L0S2
C:L1S2
T:L2S2
A:L3S0S1S2
G:L4S0S1S2
G:L5S0S1S2
C:L6S0S1S2
T:L7S0S1S2
T:L8S0S1S2
C:L9S0S1S2
G:L10S0S1
G:L11S0S1
T:L12S1A14
A:L12L10S0S2A13
C:L13S1A16
T:L14S0S2A15
G:L15S1A18
T:L16S0S2A17
G:L17S1
A:L18L19S0S1S2
C:L20S2
T:L20L21S0S1S2
T:L22S0S1S2
A:L23S0S1S2
T:L24S0S1S2
A:L25S0S1S2
T:L26S0S1S2
T:L27S0S1S2
A:L28S1A30
C:L28S0S2A29
T:L30L29S0S1S2
T:L31S1A33
C:L31S0S2A32
C:L33L32S0S1S2
T:L34S1A36
C:L34S0S2A35
C:L36L35S0S1S2
C:L37S0S2
C:L38S2A40
T:L38L37S0S1A39
T:L40L39S0S1S2
A:L41S0S1S2
T:L42S0S1S2
Personal tools
Namespaces
Variants
Actions
Main Links
documentation
community
development
Toolbox