Talk:Tricking the perl regex engine to get suboptimal matches

From BioPerl
Jump to: navigation, search

Example input file?

When I try to use bioperl-live/t/data/testaln.fasta as my input I get this error. --Jhannah 21:05, 22 February 2009 (UTC)

------------- EXCEPTION -------------
MSG: This alignment has only 411 residues. Slice start [3713] is too big.
STACK Bio::SimpleAlign::slice /Users/jhannah/src/bioperl-live/Bio/SimpleAlign.pm:1080
STACK toplevel j.pl:26
-------------------------------------

And then, even if feed it a very good FASTA alignment and comment out the entire for my $match (@matches) { block, I wind up with

Can't call method "next_aln" on an undefined value at j2.pl line 21.

So somehow $c =~ m//xig is undef'ing $in?

I tried these:

This is perl, v5.10.0 built for darwin-2level
This is perl, v5.8.8 built for i486-linux-gnu-thread-multi
This is perl, v5.10.0 built for i686-linux
  • The alignment you are using has a very poor consensus_string at 100% identity (I get no output as a result), but it doesn't fail for me. Not sure what is going on. Following is the example I used. Maybe post your version of the script? --Chris Fields 23:11, 22 February 2009 (UTC)
  • Really? I wonder what my problem is? I just tried again with your file, no luck. (1) bioperl-live r15558. (2) copy-paste the script from the wiki. (3) Change $file to $ARGV[0]. (4) Save your alignment below as cjfields.fasta. My results: --Jhannah 23:44, 22 February 2009 (UTC)
This is perl, v5.8.8 built for i486-linux-gnu-thread-multi
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: This alignment has only 407 residues. Slice start [8265] is too big.
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/jhannah/src/bioperl-live/Bio/Root/Root.pm:368
STACK: Bio::SimpleAlign::slice /home/jhannah/src/bioperl-live/Bio/SimpleAlign.pm:1080
STACK: j.pl:26
-----------------------------------------------------------

This is perl, v5.10.0 built for i686-linux
------------- EXCEPTION -------------
MSG: This alignment has only 407 residues. Slice start [34841] is too big.
STACK Bio::SimpleAlign::slice /home/jhannah/src/bioperl-live/Bio/SimpleAlign.pm:1080
STACK toplevel j.pl:26
-------------------------------------

This is perl, v5.10.0 built for darwin-2level
------------- EXCEPTION -------------
MSG: Slice start has to be a positive integer, not [-19]
STACK Bio::SimpleAlign::slice /Users/jhannah/src/bioperl-live/Bio/SimpleAlign.pm:1074
STACK toplevel j.pl:26
-------------------------------------
  • I can reproduce that if I use $ARGV[0] or the '-file => shift' idiom. It's odd and looks to me like a Bio::Root::IO or AlignIO bug. In fact, I can get this to segfault (?!?) in some cases. I've fixed the script to show the version that works, along with the bug note, and will try to isolate a specific case that triggers the issue. --Chris Fields 17:16, 23 February 2009 (UTC)
  • Hi guys. I'm not sure it's an IO issue directly. The code execution in regexes seems pretty touchy (I'll quote pod chapter & verse below). I get Jay's error on my machine (MSWin Vista/ActiveState) running the script as written, with $file set from $ARGV[0]. However, I make the following mod, wherein I eschew the check_match() subroutine and calculate the condition directly in the regex, as follows,
    $c =~ m{
         (.{18,21})
         (?{
#            my $match = check_match($1);
            push @matches, [$1, pos(), length($1)] if ($1 && (($1 =~ tr/?/?/) <= 4));
            })
         (?!)
         }xig;
and it works fine -- on testaln.fasta, no output (there are no matches meeting the condition); on cjfields.fasta, big long slice dump.
The weird error of Jay's seems to result from pos() being set WAY beyond the end of $c. In Jay's case, apparently pos() is 3713 (or prob 3712). This error shouldn't happen, since the test case should have no matches that meet the condition. Looks like this engine's jumped the track.
Here are possibly relevant sections of perlre:
Due to an unfortunate implementation issue, the Perl code contained in these blocks is treated as a compile time closure that can have seemingly bizarre consequences when used with lexically scoped variables inside of subroutines or loops. There are various workarounds for this, including simply using global variables instead. If you are using this construct and strange results occur then check for the use of lexically scoped variables.
I fooled around with scoping quite a bit (made $match, @matches global, other futzes) but continued to get SEGV or other bizarre errors. (All the runs were in the debugger under Emacs, btw).
The other section may hold some clue--it doesn't mention calling outside of the regex explicitly, but is it a hint that all is not kosher?
Because Perl's regex engine is currently not re-entrant, interpolated code may not invoke the regex engine either directly with m// or s///), or indirectly with functions such as split.
Well, that was fun. --Majensen 05:30, 26 February 2009 (UTC)
  • Wow. Quite an expedition! Thanks for all the research! I don't have a pressing need to make this work right now, we were just exploring "fuzzy match" options in Perl since my exact match tendencies may be too strict sometimes. I haven't researched Perl alternatives to this method yet either. --Jhannah 13:31, 26 February 2009 (UTC)
  • Debugging is kind of like eating potato chips: "Maybe I'll try just one more thing..." The "why the hell doesn't the damn thing work" drive is very strong in me. Just hope it'll ring bells in a guru's head (Chris?) --Majensen 13:38, 26 February 2009 (UTC)
  • BTW, does the hack above make it work for you, Jay? --Majensen 13:41, 26 February 2009 (UTC)
  • I haven't tried yet. My mentor is driving this interest, were as I tend to avoid coding on top of anything that ever does anything squirrely. -grin- He's out of town this week. I'll see what he thinks when he gets back. Thanks again! --Jhannah 13:56, 26 February 2009 (UTC)
  • Chicken! (No problem at all... :) --Majensen 14:10, 26 February 2009 (UTC)
The change above doesn't work, at least with perl 5.8.8 or 5.10 due to the the re-rentrant issue you mention above. tr/// works a bit differently but can't be called within either; you need a method call so the perl interpretor sees tr/// and precompiles it (as t/// requires). A possible workaround is to run an index() loop within the code block (haven't tested that yet). --Chris Fields 14:21, 26 February 2009 (UTC)
  • Well, I thought there might be those issues (thanks for the explan); oddly it did work for me. Just grinding it out worked:
    $c =~ m{
         (.{18,21})
         (?{
#            my $match = check_match($1);
            my $ct;
            for my $i (0..length($1)-1) { $ct++ if (substr($1,$i,1) eq '?'); }
            push @matches, [$1, pos(), length($1)] if ($ct <= 4);
            })
         (?!)
         }xig;
--Majensen 14:39, 26 February 2009 (UTC)

cjfields.fasta

>01/1-399
ATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACTATCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCATCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCTTTCTCGTCCCCATGGATGACCCCCC
>02/1-399
???????????????????????????????????????????TCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCATCCTTAACAGTACATGGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>03/1-399
??????????????????????????TTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATCTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCATACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>04/1-399
????????????????????????????????????????????????????????????
????????????????????????????ACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCCCCTCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCATCCTTAACAGTACATGGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTCCTCGTCCCCATGGATGACCCCC?
>05/1-399
???????????????????????????????????TTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAGCAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>06/1-399
??????????????????????????TTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGTCA-CCCCTCACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCACGGATGACCCCC?
>07/1-406
????????????????????TTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCA??????????????????????????????ATGCTTACAAGCAAGTACAGC
AATCGACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>08/1-399
??????????????????????????????????????TCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGTCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>09/1-399
?????????????????????TCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTCACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCC??
>10/1-399
??????????????????????????????AACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>11/1-399
????????????????????????????????CTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>12/1-399
??????????????????????????????????????????TTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCTCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAGGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>13/1-399
????????????????????????????????????????TGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATCTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCATACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCACGGATGACCCCCC
>14/1-399
??????????????????????????????????????????TTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>15/1-399
????????????????????????????????????????????????????????????
???????GTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>16/1-399
??????????????????????????TTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>17/1-399
????????????????????TTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATCTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCATACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGA??????
>18/1-399
????????????????????????????????????????TGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGAT????????
>19/1-399
??????????????????????????????????????TCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGTCA-CCTCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCACGGATGACCCCC?
>20/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCCCCTCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGTCA-CCTCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCACGGATGACCCCCC
>21/1-399
???????????????????????????????ACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACTACCTGTAGTACAT
AAAAACTCAAC--CCACATCAAAA-----CCCTGCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTGTCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGCACATAAAGTCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>22/1-399
???????????????????????????????ACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>23/1-399
?????????????????????????ATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAGCCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
GATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTCACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>24/1-399
????????????????????????????????????????????????????????????
????????TACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGCACAGC
AATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCC?
>25/1-399
??????????????????????????????AACTATTCTCTGTTCTTTCATGGGGAAGCG
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>26/1-399
??????????????????????????????AACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCAACATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>27/1-399
?????????????????????????????AAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTATCCATCCTTAACAGTACATGGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>28/1-404
???????????????????????????????????TTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATCTCGTACAT
TACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAA???????????CCCCCATGCTTACAAGCAAGCACAGC
GATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTGCCCATCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTTGTCCCCATGGATGAC?????
>29/1-404
????????????????????????????????CTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAA?????????????????????????????????????
???????????????????????????????????CCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>30/1-399
??????????????????????????????AACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAC--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCRCCCTTAACAGTACATAGCACATAAAACCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>31/1-404
??????????????????????????????????????TCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCA???????????????CCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCATCCTTAACAGTACATGGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>32/1-399
??????????????????????????????????????????TTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCAACATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAAC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTGCAGTCAAATCCTTTCTCGCCCCCATGGATGACCCCCC
>33/1-399
?????????????????????????????????????????????TTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCTCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCAT????????????
>34/1-399
?????????????????????????????????????????????????????????GCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTGACTACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCC
>35/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCAACATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
AATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>36/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AACCAACCTTCAACTATCACACATCAACTGCAACTCCAAGGCCA-CCCCTTACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>37/1-399
??????????????????????????????????????TCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAATCCAAT--CCACATCAAAA-----CCCCCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>38/1-399
?????????????????????????????????????????????TTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGCACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCC
>39/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCC
>40/1-399
????????????????????????????????????TCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCAGCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>41/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATCTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAAC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCATCCTTAACAGTACATGGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>42/1-399
????????????????????????????????????????????????????????????
????????????????????????????????ATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCATACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>43/1-399
????????????????????????????????????????????????????????????
??????????CCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCTAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGCACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCC??????????????
>44/1-399
????????????????????????????????????????????????????????????
??????GGTGCCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCAACATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAAC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAGACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTTCAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCC
>45/1-399
???????????????????????????????????TTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCC???
>46/1-399
?????????????????????????????????????CTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGCACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>47/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCAGCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
AATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCC??????????????
>48/1-399
????????????????????????????????????????TGTTCTTTCATGGGGAAGCA
GATTTGGGTGCCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>49/1-406
????????????????????????????????????????????????????????????
????????????????????????????????????????????????????????????
????????????????????????????????????????????????????????????
???????????????????????????????????????ATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATTAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCTACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCTTTCTCGTCCCCATGGATGACCCCCC
>50/1-399
????????????????????TTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAAC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGG??????????
>51/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAAC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCATCCTTAACAGTACATGGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
>52/1-399
???????????????????????????????????????????????????????AAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCC??
>53/1-399
??????????????????????????????????????????TTCTTTCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
AATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>54/1-399
????????????????????????????????????????????????????????????
??????GGTGCCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>55/1-399
????????????????????????????????????????????????????????????
???????????????????????????????????AACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCC
>56/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCTCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCC
>57/1-399
???????????????????????????????????????????????????GGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATCGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
?ATATCAACAAACCTACCCACCCTTAACAGYACATAGYACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGYCCCCATGGATGACCCCCC
>58/1-399
???????????????????????????????????????????????TCATGGGGAAGCA
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGTCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCC?
>59/1-399
????????????????????????????????????????????????????????????
??????GGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCCCCTCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAG
GATATCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGAT????????
>60/1-399
???????????????????????????????????????????????????????????A
GATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACAT
TACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT
AAAAACCCAAT--CCACATCAAAA-----CCTTCCCCCCATGCTTACAAGCAAGTACAGC
AATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA-CCCCTTACCCATTAG
GATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCC?

Personal tools
Namespaces
Variants
Actions
Main Links
documentation
community
development
Toolbox