Tinyseq sequence format

From BioPerl

Jump to: navigation, search


Description

Tinyseq is an XML based format for plain sequences. Details are available in the NCBI documentation.

This file format can be parsed by the Bio::SeqIO system using the Bio::SeqIO::tinyseq module.

Example

<?xml version="1.0"?>
<!DOCTYPE TSeqSet PUBLIC "-//NCBI//NCBI TSeq/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_TSeq.dtd">
<TSeqSet>
  <TSeq>
    <TSeq_seqtype value="nucleotide"/>
    <TSeq_gi>11321596</TSeq_gi>
    <TSeq_sid>ref|NM_002253.1|</TSeq_sid>
    <TSeq_taxid>9606</TSeq_taxid>
    <TSeq_orgname>Homo sapiens</TSeq_orgname>
    <TSeq_defline>Homo sapiens kinase insert domain receptor, mRNA</TSeq_defline>
    <TSeq_length>58</TSeq_length>
    <TSeq_sequence>ACTGAGTCCCGGGACCCCGGGAGAGCGGTCAGTGTGTGGTCGCTGCGTTTT</TSeq_sequence>
  </TSeq>
</TSeqSet>
Personal tools