XMFA multiple alignment format

From BioPerl
Jump to: navigation, search

A modification of the FASTA multiple alignment format that allows for multiple alignments in a file. More information is on the MAUVE site

The defline contains the following in its header: >seqname:start-stop strand comments

   >1:1-598 + chrY
   TCCAAGTCGGCTTTATGTTTGCTTCTGCCAGGCATTCTAGATGCCCCATGTCTAGGATCT
   CTTTAGGCAGGAGAGAGGGTGATGGTGTAGGAGGACCCATTTCTTGGCTTGCAGATTCCA
   ATAATAAAAAAGTCACAGATTTAAACCCCAAACTTTGATGAAATGCAGGTCTAGGGTTTT
   AAAATATAATGAGAGTTAAATACTTTTGTATTTTCTTCATCCAGAGATGGGGCAAGCTTC
   CTCATCTGCTCGTTCATGGGTGATTTATATTTTCCCCACTCCATCCTTTTCCTAAGGTAT
   TTTTTTTTTAGGGACAATGGCTTTTTGCAGAGTACTCAGTTCCAGCTCCGGGGGCACCGG
   TTGAGCCCTTACCGTCCTGCCCCTAAACATCCAGACCTCAAGTTAGAGAGGGGAGTAACA
   TTTGGGGGGTGCCCACACCTAGGAGGACCAATCCTTCTGGTTTCCTTAGGGATGCAGGAA
   TTTGGGGGGGGGGGGCTCAGTGCTAAAACCAGTAGAGTCCTGGGCAAACGAGTATGACTG
   AAGATGCTTTGAACACCCTAGCGTTATGTCGATCGCATGCATCGTAGTGTCGCTGATG
   >2:5000-5598 - chr17
   TGCAGATTGGCCTT-TGTTTCGTTTTTC-AAGCGTT-TAAA--CGCCTTGCCTAAGAATC
   TTTT--GCAGGGAAGGGGATAGTGAACTGGGAAAACCTGGCTCTTCCTTTCGAGATTCCA
   GTAACAAACATGTCATAACTATAAACGCCAAACTTGG--AGAGCGCAGGAATGGAAGGTC
   AAACACCAATGAGAGTTAGATGGTTTTGGGTTT----------------------GCT--
   CTAGTCTGCACG-------GTGCTCCCCGTCCCCTCACGTCCGTGCTTTTCCTCAGGATG
   ATGCCTTGCCAGAACACCGGTGTGCTGCAAGGTGCTCAGCTCCAAATCGGGCTGCACCGC
   TTCAGCTTTCCCCATCCAGCCA--ACGCAGGAAGGCCTGGAGCTACAGAGTTTAGAGCCA
   TCTCTCCGCTGCTCAT--------TAACCAACCATTCCAGCT-------GTCTGTAGTGG
   GTTTTTTTCTT----CTCTACACTAAAATGAGGACAGTCCAGGCCCTTTG--TTAGACTG
   AAGATGCTTTGAACACCCTAGCGTTATGTCGATCGCATGCATCGTAGTGTCGCTGATG
   >3:19000-19598 - chr7
   TCCAGACTGTCTTT-TGCTCCCTTTTTCCGAGCATT-TAAAAATACCATGCCTAAGAATC
   TTTT--GCAGGGAAGGGGATAGCGAGCTGGGAAGGCCTATTTCTTCATTTCGAGATTCTG
   GTAATAAACATGTCATAAATATAAATGCCAAACTCCG--GAAATGCAGGTGTAGAGCGTC
   AGATTCTATTTGGACTTAAATGATGTGGTGTTTT---------------------GCT--
   CTAATTTCTACC-------GTGCTCTCCGTTCC-TCAAGTCCATGCATTTCCTTAGGGTG
   CTGCCTTTCCAGAGTACTGGTATGCTGCAGGGTGCTCAGTTCCACATCTGTCTGCACTAT
   TTCAAAGTTTCCC-TCCAGCCC--ACACAACTATGCCTAGAGCTA--GAGGTTAGAACCG
   TCTGTCCA-TGCTCTT--------TAACCAACCACTCCAGAT-------AGGTGTGGTGG
   TTTTTTTTTTTTTTTCTCTGTACTAAAATTAGGACAGTCCAGGCCTGTTG--TTAGACCA
   AAGATGCTTTGAACACCCTAGCGTTATGTCGATCGCATGCATCGTAGTGTCGCTGATG
   = score = 111
   >1:1000-1060 + chrY
   CACTCTAATAGTAAAGTTTCTTTTGCTGTGCAGAAGCTCTTTAGTTTAATTAGATCCCAT
   >2:6000-6060 + chr17
   CACTCTAATACTAAACTTTCTTTTCCTCTCCACA----CTTTACTTTAATTACATCCCAT
   >3:20000-20060 - chr12
   CACTCTAATAGTAAAGTTTCTT----TGTGCAGAAGCTCTTAGTTTTAATTAGATCCCAT
   = score = 11
Personal tools
Namespaces
Variants
Actions
Main Links
documentation
community
development
Toolbox